CrossPart Help

Welcome!

This community is for professionals and enthusiasts of our products and services.
Share and discuss the best content and new marketing ideas, build your professional profile and become a better marketer together.

0

Cột sắc ký lỏng AQ-C18 (150 mm x 4.6 mm, kích thước hạt 3 µm)

Avatar
CP
1 Acetone 2.5 L/chai Chai A/0606/17 Độ tinh khiết ≥ 99 %; A.C.S. Reagent; chai thủy tinh tối màu. Hạn sử dụng:  ≥ 12 tháng   
2 Acetonitrile 4 L/Chai Chai A998-4, Fisher (Mỹ) Độ tinh khiết ≥ 99 %; chai thủy tinh màu tối; dung môi dùng cho sắc kí lỏng (HPLC); ACS. Hạn sử dụng:  ≥ 12 tháng  
3 Acid acetic 1 L/chai Chai Merck100063100 Độ tinh khiết từ  ≥ 95%, Analytical Reagent, ACS; chai thủy tinh tối màu, dung dịch trong suốt, không màu, không cặn. HSD:  ≥ 12 tháng  
4 Acid formic 1 L/chai Chai Merck1116701000 Nồng độ ≥98%, chai thủy tinh  1L,  Suprapur®, hạn sử dụng trên 2 năm, không màu.
5 Acid Phenylboronic  (95%) 100 g/Chai  Chai TRC P319590 - 100G  Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
6 Acid Trichloroacetic  1 kg/chai Chai Sigma T4885-1KG Độ tinh khiết ≥ 99%,  ACS reagent
7 Aflatoxin M1 5 ml/ Chai Chai 10000349; Romer Lab, Áo Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
8 Aniracetam 250 mg/Chai Chai TRC-A672800-250MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
9 Baird parker agar 500 g/Chai Chai 1054060500, Merck Dạng hạt (GranuCult), thành phần (g/l): Enzymatic Digest of Casein 10; Meat Extract 5; Yeast Extract 1; Sodium Pyruvate 10; Glycine 12; Lithium Chloride 5; agar 15. pH ở 25oC sau khi hấp là: 6,8 ± 0,2. HSD:  ≥ 24 tháng  
10 Bolton Broth Base 500 g/Chai Chai 1000680500, Merck Thành phần (g/l): Dạng hạt; Enzymatic digest of animal tissues 10.00; Lactalbumin hydrolysate 5.0; Yeast extract 5.0; Sodium chloride 5.0; Sodium metabisulphite 0.5; Sodium carbonate 0.6; Hemin 0.01; alpha-ketoglutaric Acid 1.0; Sodium pyruvate 0.5; Final pH ( at 25°C) 7.4±0.2
11 Bolton Selective Supplement 10 lọ/Hộp Hộp 1000790010, Merck Thành phần: Xefoperazon  0,02 g; Vancomyxin  0,02 g, Trimetoprim lactat  0,02 g; Amphoterixin B  0,01 g
12 Bovine serum Chai/10 g Chai SigmaA9647-10g Độ tinh khiết ≥ 98%; pH ≥ 6,5; Nitrogen ≥ 14,5%
13 Butyl benzyl phthalate (BBP), CAS No. 85-68-7 Chai(250mg) chai HPC (Đức)/678979 Độ tinh khiết ≥ 98.8%, hạng sử dụng ≥ 12 tháng
14 CCDA Selective Supplement 10 lọ/Hộp hộp 1000710010, Merck Thành phần (g/lọ): Cefoperazone 0,016; Amphotericin B 0,005. pH 7.0 - 7.4 (25 °C). HSD:  ≥ 24 tháng 
15 Chất chuẩn Iodide (I) Chai/100 ml Chai Sigma-Aldrich/41271-100ML Dùng cho IC, 1000 mg/l 
16 Chuẩn 1,3-Dimethylamylamine 100 mg/Chai Chai SIGMA 93909-100MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
17 Chuẩn 19-Nor-4-androstene-3,17-dione  50 mg/ Chai Chai DRE-C15639500-50MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
18 Chuẩn 2,2,2-trifluoroethanol 250 ml/chai Chai 8082590250, Sigma aldrich
19 Chuẩn 2,2,2-trifluoroethanol 250 ml/chai Chai 8082590250, Sigma aldrich
20 Chuẩn 2'-Fucosyllactose (~90%) 10 mg/Chai Chai F836138-10MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
21 Chuẩn 3-Fucosyllactose 1 mg/Chai Chai F836140-1MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
22 Chuẩn 3'-Sialyllactose Sodium Salt 10 mg/Chai Chai S397400-10MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
23 Chuẩn 4-hydroxyandrosten- edione 500 mg/Chai Chai F692250-500MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
24 Chuẩn 4-Hydroxybenzhydrazide 100g/Chai  Chai SigmaH9882-100G Độ tinh khiết >=97%
25 Chuẩn 6'-Sialyllactose Sodium Salt 10 mg/Chai Chai S397405-10MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
26 Chuẩn Acid Pentadecafluorooctanoic 50 μg/mL trong MeOH 1 Ống/hộp Hộp CIL-ULM-7451-1.2, LGC
27 Chuẩn Acid Pentadecafluorooctanoic 50 μg/mL trong MeOH 1 Ống/hộp Hộp CIL-ULM-7451-1.2, LGC
Độ tinh khiết ≥ 96%, hạng sử dụng ≥ 12 tháng
28 Chuẩn AgNO3 0.1N 1 Ống/hộp Hộp Merck1099900001 Cho 1000 ml, Titrisol®, nồng độ: 0,1mol/l (0,1N). Có ngày tháng hạn sử dụng cụ thể. Có liên kết chuẩn từ NIST. Đạt DIN EN ISO/IEC 17025. 
29 Chuẩn Androsta-1,4-diene-3,17-dione (Androstadienedione) 25 mg/Chai Chai LGC MM0323.07-0025 -25 mg Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
30 Chuẩn axit percloric 0.1 N 1l/chai Chai Merck1090651000 Nồng độ (0,0995 - 0,1005)N,độ không đảm bảo đo +/- 0,0003, Titripur® Reag. Ph Eur, Reag. USP, chai thủy tinh  1L, hạn sử dụng trên 2 năm, có liên kết chuẩn NIST SRM,  được công nhận theo DIN EN ISO / IEC 17025
31 Chuẩn Chlorpromazine 1 g/Chai Chai TRC C424750 - 1G  Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
32 Chuẩn Dapoxetine Hydrochloride 10 mg/Chai Chai TRC - D185700 - 10MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
33 Chuẩn Desmethylsildenafil 5 mg/Chai  Chai TRC D292200 - 5 MG  Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
34 Chuẩn Di-(2-ethylhexyl) phthalate (DEHP), CAS No. 117-81-7 500 mg/Chai Chai HPC (Đức)/676542 Độ tinh khiết ≥ 96.5%, hạng sử dụng ≥ 12 tháng
35 Chuẩn Dialkyl Phthalate, CAS No.68515-42-4 250 mg/Chai Chai DR.E / TRC-D414900-250MG Độ tinh khiết ≥ 90%, hạng sử dụng ≥ 12 tháng
36 Chuẩn Di-butyl phthalate (DBP), CAS No. 84-74-2 500 mg/Chai Chai HPC (Đức)/ 678980 Độ tinh khiết ≥ 98%, hạng sử dụng ≥ 12 tháng
37 Chuẩn Dibutyltin-dichloride 0.25g/chai Chai C 12258000, Dr.E Độ tinh khiết ≥ 96.5%, dạng bột, màu trắng, hạn sử dụng ≥ 12 tháng
38 Chuẩn Di-iso-decyl phthalate (DIDP), CAS No. 26761-40-0 100 mg/Chai Chai HPC (Đức)/677185 Độ tinh khiết ≥ 99.8%, hạng sử dụng ≥ 12 tháng
39 Chuẩn Di-isononyl phthalate (DINP), CAS No. 28553-12-0 250 mg/Chai Chai HPC (Đức)/678290 Độ tinh khiết ≥ 99.8%, hạng sử dụng ≥ 12 tháng
40 Chuẩn Hydrocortisone 1 g/Chai Chai Sigma -H4001-1G Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
41 Chuẩn Hydroxyacetildenafil 5 mg/Chai  Chai TRC H739940 - 5 MG  Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
42 Chuẩn KMnO4 0.1 N 1l/chai Chai merck1091221000 Hóa chất chuẩn dùng trong phân tích.c(KMnO₄) = 0.02 mol/l (0.1 N) Titripur®,Có liên kết chuẩn từ NIST. Đạt DIN EN ISO/IEC 17025
Reag.USP.
43 Chuẩn Lacto-N-tetraose 2.5 mg/Chai Chai L300210-2.5MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
44 Chuẩn Naproxen 1 g/Chai Chai TRC N377520 - 1G Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
45 Chuẩn Natrithiosulfate 0.01 N 1 Ống/Hộp Hộp Merck1099090001 Nồng độ 0,1M, quy cách 1 ống/chai, hạn sử dụng trên hai năm, Titrisol®, có liên kết chuẩn NIST SRM,  được công nhận theo DIN EN ISO / IEC 17025
46 Chuẩn Oxiracetam 50 mg/ Chai Chai TRC-O846905-50MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
47 Chuẩn Perfluorooctanesulfonate (PFOS) (mix of isomers) 1 Ống/Hộp Hộp CIL-ULM-10655-1.2, LGC
48 Chuẩn Perfluorooctanesulfonate (PFOS) (mix of isomers) 1 Ống/Hộp Hộp CIL-ULM-10655-1.2, LGC
49 Chuẩn Phenylpiracetam 100 mg/Chai Chai TRC-C184315-100MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
50 Chuẩn Picamilon 1 g/Chai Chai TRC-N431240-1G Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
51 Chuẩn Piracetam 5 g/Chai  Chai TRC-P500800-5G Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
52 Chuẩn Prednisolone 100 mg/Chai Chai Sigma P6004-100MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
53 Chuẩn Prednisone 100 mg/Chai Chai TRC P703780 - 100 MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
54 Chuẩn Sodium perfluorooctanesulfonate (PFOS) 50 ug/ml trong Methanol 1 Ống/Hộp Hộp CIL-ULM-9001-1.2, LGC
55 Chuẩn Sodium perfluorooctanesulfonate (PFOS) 50 ug/ml trong Methanol 1 Ống/Hộp Hộp CIL-ULM-9001-1.2, LGC
56 Chuẩn Thioaildenafil 2 mg/ Chai Chai TRC T344365 - 2MG Độ tinh khiết ≥ 95%, Hạn sử dụng ≥ 2 năm, tinh khiết dùng cho phân tích
57 Coagulase Plasma Rabbit 10 lọ/Hộp hộp 240658, BD-Difco Huyết tương thỏ đông khô với 0,85% sodium citrate và 0,85% sodium chloride, màu nâu nhạt, quy cách 1 hộp gồm 10 lọ x 3mL/lọ; bảo quản 2-8oC. HSD:  ≥ 18 tháng  
58 Cồn đốt / L Chemsol Nồng độ Ethanol >96%
59 Cột chiết Aflatoxin M1 25 cột/ hộp Hộp VICAM G1007 Cột ái lực miễn dịch chiết Aflatoxin M1. Dung tích cột ≥ 3 ml. Hạn sử dụng  ≥ 2 năm
60 Đĩa petrifilm kiểm tra E.coli/ Coliform  500 Đĩa/Thùng Thùng 6414, 3M Đĩa giấy môi trường sử dụng ngay có chứa chất chỉ thị màu cho hoạt tính glucuronidase (BCIG) và chất chỉ thị tetrazolium. HSD:  ≥ 12 tháng.
61 Dung dịch bảo quản điện cực KNO3 1mol/L 250 ml/chai Chai Merck/51350078 Dung dịch KNO3 1 mol/L
62 Dung dịch làm lạnh
ICP-MS Chiller Coolant Mix               
1 L /Chai Chai Perkin Elmer / WE016558           Phù hợp cho máy ICP-MS Nexion 350X của Perkin Elmer
63 Ethanol absolute  2.5 L / Chai Chai VWR ( Mỹ) / 153386F Độ tinh khiết ≥ 99%, hạng sử dụng ≥ 12 tháng
64 Formaldehyde 37% 100 ml/Chai chai 252549, sigma aldrich Độ tinh khiết ≥ 37% trong nước, 10-15% MeOH, hạng sử dụng ≥ 12 tháng
65 FRUCTAN KIT Hộp Hộp MegazymeK-FRUC Gồm:
- Chai 01: sucrase/amylase mixture,
- Chai 02: Frutanase,
- Chai 03: Inulin control - Inulin = 14,7%,
- Chai 04: Levan control - Levan = 10,7%,
- Chai 05: Sucrose control - Sucrose = 8,4%,
- Chai 06: Fructose standard 5 ml, 1,5mg/ml in 0,2% benzoic acid
Phù hợp với phương pháp AOAC 999.03 và 2018.07
66 Hexan 4L/Chai Chai Fisher-Mỹ, H292-4 Độ tinh khiết ≥ 98,5%; A.C.S. Reagent; chai thủy tinh tối màu. Hạn sử dụng:  ≥ 12 tháng   
67 High Purity Standards Solution A of 68 Element Standard 100mL/Chai Chai ICP-MS-68B-A, High Purity Độ tinh khiết ≥ 99.9%, hạng sử dụng ≥ 12 tháng
68 Infant/Adult Nutritional Formula 10 gói/ Hộp Hộp NIST 1849a  Nền mẫu sữa bột, bao gồm các nguyên tố: Ca , Cr , K, Mg, Zn, P,  Se, Cu, Fe, Na, I, Mn, Mo; Vitamin A, D, B; Fatty Acids; Amino Acids; Ash; Calories (kcal/100g); Cholesterol; Carbohydrates; Fat (extracted); Sum of Fatty Acids (as triglycerides); Protein; Solids; Nucleotides; Lactose; myo-Inositol; Tocopherols. Hạn sử dụng: ≥ 12 tháng
69 IRIS Salmonella ® Agar 500g / Chai Chai BK212HA, Biokar Thành phần (g/l): Peptone 10,0 g; Yeast extract 5,0 g; sodium chloride 5,0 g; Phosphate buffer 7,0 g; Selective agents 10,2 g; Chromogenic mixture 1,0 g; Bacteriological agar 16,0 g; Opacifying agents 6,5 g; pH ở 25°C : 7,0 ± 0,2.
70 Kit thử độc tố Staphylococcus aureus 96 giếng/Bộ  Bộ R4105; R-Biopharm Bộ 96 giếng. Xác định độc tố tụ cầu (staphylococcal enterotoxin - SET) A, B, C, D, E trong mẫu thực phẩm và dịch nuôi cấy chủng. Giới hạn phát hiện trong mẫu lỏng: 0,25 ng độc tố/ml mẫu; mẫu đặc: 0,375 ng độc tố /g mẫu; dịch nổi nuôi cấy vi khuẩn: 0,25 ng độc tố/ml mẫu. HSD:  ≥ 12 tháng  
71 Kit thử độc tố tiêu chảy của Bacillus cereus 20 test/Bộ  Bộ TD0950; Oxoid Test thử độc tố gây tiêu chảy của Bacillus cereus bằng kỹ thuật ngưng kết latex thụ động đảo ngược (RPLA). Độ nhạy của bộ kit:  2ng / ml dịch chiết mẫu thử nghiệm; 4ng/g mẫu thực phẩm. HSD:  ≥ 12 tháng
72 Magnesium oxit 500 g/chai Chai Merck1058660500 Hàm lượng ≥ 97 %, đựng trong chai nhựa màu trắng quy cách 500g/chai, tỷ trọng 3,580 g / cm3. Hạn sử dụng trên 2 năm.
73 mCCD (Modified charcoal cefoperazone deoxycholate) agar (base) 500 g / Chai chai 1000700500, Merck Thành phần (g/l): Dạng hạt, Peptones 20.0; Casein hydrolysate 30.; Activated charcoal 4.0; Sodium deoxycholate 1.0; Sodium pyruvate 0.25; Ferrous sulfate 0.25; Agar-agar 12.0. pH 7,4 ± 0,2. HSD ≥ 24 tháng
74 Membrane - filter Enterococcus selective agar acc to Slanets - Barley (TTC agar) 500 g/ chai Chai 1052620500, Merck Đóng gói trong chai nhựa 500g, dạng hạt, thành phần gồm (g/l): Tryptose 20.0; Yeast Extract 5,0 sodium azide 0,4; di-potassium hydrogen phoshate 4,0; 2-3-5 TTC 0,1; D-glucose 2,0. pH: 7,2 ± 0.2 tại 25°C. Đính kèm CA và MSDS
75 Methanol  4 L/Chai Chai A452-4, Fisher (Mỹ) Độ tinh khiết ≥ 99,9%, ACS; chai thủy tinh tối màu, dùng cho HPLC. Hạn sử dụng:  ≥ 12 tháng  
76 Mix Quechers ( MgSO4_1,2g; Diamino_0,4g; C18_0,4g) 50 Ống /Hộp Hộp COQ015033H Biocomma (Trung Quốc) Thành phần: MgSO4_1,2g; Diamino_0,4g, C18_0,4g . Reagent grade 
77 Mix Quechers liquid extraction (MgSO4_6g; CH3COONa_1,5g) 100 gói /Hộp Hộp Q050020P Thành phần: MgSO4_6g; CH3COONa_1,5g. Reagent grade 
78 Mồi 100 nM   100 nM/ống ống IDT Trình tự nucleotide mạch đơn ngắn tổng hợp (oligonucleotide) từ 18 - 25 nucleotide. Nồng độ 100nM
79 Mồi 25 nM  25 nM/ống ống IDT Trình tự nucleotide mạch đơn ngắn tổng hợp (oligonucleotide) từ 18 - 25 nucleotide. Nồng độ 25nM
80 NexION Dual Detector Calibration Solution   100 ml /Chai Chai Perkin Elmer / N8145059 Phù hợp cho máy ICP-MS Nexion 350X của Perkin Elmer. HSD: ≥ 12 tháng
81 NexION KED Setup Solution 250 mL  250 ml /Chai Chai Perkin Elmer / N8145052  Phù hợp cho máy ICP-MS Nexion 350X của Perkin Elmer. HSD: ≥ 12 tháng
82 NexION Setup Solution 500 mL   500 ml /Chai Chai Perkin Elmer / N8145051 Phù hợp cho máy ICP-MS Nexion 350X của Perkin Elmer. HSD: ≥ 12 tháng
83 Nội chuẩn Perfluorooctanoic acid (PFOA) (13C8,99%) 50 µg/mL trong Methanol 1 ống/hộp Hộp CIL-CLM-8005-1.2, LGC
84 Nội chuẩn Perfluorooctanoic acid (PFOA) (13C8,99%) 50 µg/mL trong Methanol 1 ống/hộp Hộp CIL-CLM-8005-1.2, LGC Độ tinh khiết ≥ 99%, hạng sử dụng ≥ 12 tháng
85 Nội chuẩn Praseodymium (Pr) Chai/100 ml Chai Supelco/ 59947-100ML dùng cho ICP, nồng độ 1000 mg/l
86 Nội chuẩn Samarium (Sm) Chai/100 ml Chai Supelco/ 1703480100 dùng cho ICP, nồng độ 1000 mg/l
87 Nội chuẩn Sodium perfluorooctanesulfonate (PFOS) (13C8, 99%) 50 µg/mL trong Methanol 1 Ống /Hộp Hộp CIL-CLM-8505-1.2, LGC
88 Nội chuẩn Sodium perfluorooctanesulfonate (PFOS) (13C8, 99%) 50 µg/mL trong Methanol 1 Ống /Hộp Hộp CIL-CLM-8505-1.2, LGC
89 Potassium hexacyanoferrate(II) trihydrate 500 g/chai Chai Merck - 1.04984.0500 Hóa chất dùng trong phân tích. ACS , ISO, Reag. Ph Eur; dạng bột ; độ tinh khiết ≥ 99%. Hạn sử dụng:  ≥ 18 tháng  
90 Probe - Cy5/BHQ2 100 nM/Ống  Ống IDT Mẫu dò DNA, đầu 5' gắn chất huỳnh quang Cy5; đầu 3' gắn quencher BHQ2. Nồng độ 100nM
Trình tự: pUC19 probe - /Cy5/TAAGGAGAAAATACCGCATCAGGCGCC/BHQ2/
91 Probe - Cy5/lowa Black RQ-Sp 100 nM/Ống  Ống IDT Mẫu dò DNA, đầu 5' gắn chất huỳnh quang Cy5; đầu 3' gắn quencher lowa Black RQ-Sp. Nồng độ 100nM
Trình tự: InCP - Cy5/AGCTAGTCGATGCACTCCAGTCCTCCT/Iowa Black RQ-Sp/
92 Probe - FAM/MGB NFQ 100 nM/Ống  Ống IDT Mẫu dò DNA, đầu 5' gắn chất huỳnh quang FAM; đầu 3' gắn quencher MGB NFQ. Nồng độ 100nM
Trình tự:: ailb probe - /FAM/TGACCAAACTTATTACTGCCATA/MGB NFQ/
93 Probe - FAM/TAMRA 100 nM/Ống  Ống IDT Mẫu dò DNA, đầu 5' gắn chất huỳnh quang FAM; đầu 3' gắn quencher TAMRA. Nồng độ 100nM
Trình tự: CronoP - FAM/AGAGTAGTAGTTGTAGAGGCCGTGCTTCCGAAAG/TAMRA/) 
94 Probe - FAM/TAMRA 100 nM/Ống  Ống IDT Mẫu dò DNA, đầu 5' gắn chất huỳnh quang FAM; đầu 3' gắn quencher TAMRA. Nồng độ 100nM
Trình tự:Yeb probe - /FAM/TCTATG G C AGTA ATAAGTTTGGTC ACGGTGATCT/TAMRA/
95 Pseudomonas agar P, base 500 g/ chai Chai 1109880500, Merck Thành phần (g/l): Peptone 20.0; magnesium chloride 1.4; potassium sulfate 10.0;
agar-agar 12.6. pH: 7.2 ± 0.2 ở 25 °C. HSD ≥ 18 tháng
96 Quality Control Std 26 in 4% HNO3 + Tr HF 100 ml / Chai Chai High Purity Standards / QCS-26-100ML Nồng độ 100 µg/mL ( Al, Sb, As, Ba, Be, B, Cd, Ca, Cr, Co, Cu, Fe, Pb, Mg, Mn, Mo, Ni, K, Se, Si, Ag, Na,Tl,Ti,V,Zn); pha trong 4% HNO3, tr acid hydrofluoric ;ISO/IEC 17025; ISO GUIDE 34. HSD: ≥ 12 tháng
97 Simmons citrate 500g/ chai Chai 1025010500, Merck Dạng hạt (Granucult). Thành phần: Ammonium Dihydrogen Phosphate 1 g/l; K2HPO4 1 g/l; NaCl 5 g/l; Sodium Citrate 2 g/l; MgSO4 0.2 g/l; Bromothymol Blue 0.08 g/l; Agar-Agar 13 g/l. pH ở 25°C 6,4 - 6,8. HSD ≥ 18 tháng
98 Sodium chloride 1000g/ chai Chai VWRC27810.295, VWR Công thức: NaCl, Trọng lượng phân tử: 58,44 g / mol; Điểm sôi: 1413 ° C (1013 hPa);  Nhiệt độ nóng chảy: 801 ° C; Mật độ khối: 2,16 g / cm³ (20 ° C); Nhiệt độ lưu trữ: Môi trường xung quanh
99 Sodium tetraethylborate 1 g/chai Chai 481483, Sigma aldrich Độ tinh khiết ≥ 96.5%, dạng bột, màu trắng, hạn sử dụng ≥ 12 tháng
100 Tetramethylammonium hydroxide solution 25 wt. % in H2O 1 L/Chai Chai Sigma Aldrid/331635-1L Nồng độ: 24,0- 26,0 % trong nước, chỉ số khúc xạ ở 20oC: 1,378- 1,384, chai thủy tinh tối màu
101 Tin(II) chloride 500 g/chai Chai Sigma 208256-500G Độ tinh khiết ≥ 99%, ACS, Reag. Ph Eur
102 Triple sugar iron agar (TSI) 500 g/ chai Chai 1039150500, Merck Dạng hạt (Granucult). Thành phần (g/l): Peptone from casein 10.0; peptone from meat 10.0; meat extract 3.0; yeast extract 3.0; sodium chloride 5.0; lactose 10.0; sucrose 10.0; D(+)glucose 1.0; ammonium iron(III) citrate 0.5; sodium thiosulfate 0.5; phenol red 0.024; agar-agar 12.0. pH ở 25 °C 7.4 ± 0.2. HSD ≥ 24 tháng
103 Tryptic Soy Agar (TSA) 500 g/ chai Chai 1054580500, Merck Đóng gói trong chai nhựa 500g, dạng hạt (granucult). Thành phần: Pancreatic Digest of Casein 15 g/l; Papaic Digest of Soya Bean 5 g/l; NaCl 5 g/l; Agar-Agar 15 g/l. pH 7,3 ± 0,2. HSD ≥ 24 tháng
104 Tryptic Soy Broth (TSB) 500 g/ chai Chai 1054590500, Merck Thành phần (g/l): Pepton from casein 17; Pepton from soymeal 3; D(+)-Glucose monohydrate 2,5; Sodium chloride 5; di-Potassium hydrogen phosphate 2,5. pH 7,3 ± 0,2. HSD ≥ 24 tháng
105 Zinc sulfate heptahydrate 1 kg/chai Chai VWR-Pháp, code 29253.293 Hóa chất dùng trong phân tích. ACS , ISO, Reag. Ph Eur; dạng bột ; độ tinh khiết ≥ 99%. Hạn sử dụng:  ≥ 18 tháng  
121 Danh mục dụng cụ,vật tư tiêu hao
1 Bếp đun bình cầu 1000mL / Cái Electrothermal; EM1000/CE Dung tích 1000ml;
Yêu cầu điện 230VAC 50 / 60Hz, 300W;
Vỏ ngoài bằng polypropylene kháng hóa chất; Nhiệt độ phần tử tối đa 450 ° C;Kích thước (d x w x h), mm (310 x 238 x 145); trọng lượng 1.25 kg.
2 Bình tam giác 500 mL cổ mài có kèm nắp / Cái Duran; 241934603 Bao gồm phần thân bình và nắp đậy chất liệu thủy tinh trong suốt; thể tích bình 500 mL; cổ bình mài có kích thước 29/32; thân bình có vạch chia  có nhãn bằng men trắng; nút mài cho cổ bình kích thước 29/32; Dùng cho các ứng dụng có nhiệt độ cao.
3 Bình triển khai cái cái Duran 24.209.49.03 làm bằng thủy tinh borosilicate 3,3 chịu nhiệt, đường kính 115mm, chiều cao 253mm, dung tích chứa 1575ml, có nắp thủy tinh nút mài , 
4 Bộ đỡ cột bảo vệ (Guard holder) / Cái Dikma  – Trung Quốc/ 6220 Vật liệu:  thép không gỉ, để chứa tiền cột (guard column), tương thích với cột bảo vệ sắc ký (All-guard cartridges C18, NH2)
5 Bộ phân phối chất lỏng tự động 10-60ml Bộ Bộ HirschmannZ341517 Piston làm bằng AL2O3 99,7%, Barrel  làm bằng thủy tinh borosilicate,  dung tích 10-60ml, độ chính xác CV%=0,1, vạch chia thể tích  1,0ml, có van tuần hoàn.
6 Bộ phân phối chất lỏng tự động 5-30ml cái cái HirschmannZ341509 iston làm bằng AL2O3 99,7%, Barrel  làm bằng thủy tinh borosilicate,  dung tích 5-30ml, độ chính xác CV % = 0,1%, vạch chia thể tích 0,5ml, có van tuần hoàn.
7 Bộ PM kit cho bơm / Bộ Agilent – Đức/G1310-68741 Dùng cho bơm 1260 cùa LC Infinity Agilent
8 Buồng tiêm mẫu dùng cho GC-MS (Liner cho GC-MS) 5 Cái/Hộp  Hộp Agilent – Mỹ/5190-3163 Vật liệu: Thủy tinh, silan hóa, ultra inert, single taper, không chia dòng, có nhồi sẵn bông thủy tinh, có kèm oring, dung tích 900ul, phù hợp với GCMS 5973
9 Buồng tiêm mẫu dùng cho GC-MSMS (Liner cho GC-MSMS) 5 Cái/Hộp  Hộp Thermo - 453A1925 Thủy tinh, silan hóa, ultra inert, single taper, không chia dòng, có nhồi sẵn bông thủy tinh, đường kính 4mm, chiều dài 78.5mm, phù hợp với máy Thermo Trace 1310
10 Buret thủy tinh thẳng 10ml / Cái Wertlab buret vật liệu thủy tinh borosilicat 3.3, có khóa PTFE; thể tích 10 ml
- Vạch chia: 0.05 ml
- Sai số: ± 0.03 ml
- Đáp ứng tiêu chuẩn DIN ISO 385 và USP
11 Chai chứa mẫu 2 mL làm bằng thủy tinh trong suốt  100 cái/Hộp Hộp Membrane Solutions – Trung Quốc/ LBSV022C Chai trắng, có răng ốc, có nhãn (label), đáy bằng, kích thước: ≥ 11,6 mm x 32 mm
12 Chai nâu 12mL đựng chuẩn (có nắp) 100 chai/Hộp Hộp Agilent – Mỹ/5183-4322 Thuỷ tinh màu nâu, dung tích 12 ml, dài 65 mm, rộng 19 mm, có septa hai mặt (PTFE/Silicon), nắp vặn là nhựa polypropylen, kích thước nắp 15-425 mm
13 Chai thủy tinh 1000ml Chai Chai Duran Chất liệu Borosilicate 3.3; Có thể tiệt trùng ở 121 độ C; Đạt ISO 4796-1; Đường kính đáy chai: 101mm; Chiều cao: 225mm; Dung tích: 1000ml; cổ chai kích cỡ GL45
14 Chai thủy tinh 500ml Chai Chai Duran Chất liệu Borosilicate 3.3; Có thể tiệt trùng ở 121 độ C; Đạt ISO 4796-1; Đường kính đáy chai: 86mm; Chiều cao: 176mm; Dung tích: 500ml; Cổ chai kích cỡ GL45
15 Chén kết tinh 150 ml 10 cái/hộp Hộp Duran21.311.41.02 Đường kính 80mm, chiều cao 45mm, có mỏ, làm bằng thủy tinh borosilicate, theo tiêu chuẩn DIN 12338.
16 Chén nung có mỏ cái cái Jipo, Tiệp Khắc205/5 Cốc đốt phá mẫu 103ml cao thành có mỏ, đường kính 70mm cao 35mm
17 Cột bảo vệ (Guard column HILIC) và bộ đỡ cột (Holder) / Bộ GL Sciences – Nhật/ 5020-19375 Bộ bao gồm 2 cột bảo vệ và 1 đỡ cột. Cột bảo vệ dài 10 mm, đường kính trong 1,5mm, kich thước hạt 3um. Tương đương cột bảo vệ HILIC và bộ đỡ Inertsil
18 Cột bảo vệ C18 5 cái/Hộp Hộp Dikma – Trung Quốc/ 6211 Pha tĩnh C18, tương thích với bộ đỡ cột bảo vệ Dikma
19 Cột Primesep AP, 4.6x150 mm, 5 µm, 100A 1 cái/Hộp Hộp Silec AP-46.150.0510 Pha tĩnh silica có nhóm amino ( silica-based amino-colum), đặc tính ưa nước. Tương đương cột Primesep AP
20 Cột Primesep B4, 4.6x150 mm, 5 µm, 100A 1 cái/Hộp Hộp Silec B4-46.150.0510 Cột pha đảo có gắn nhóm ghép cặp ion. Tương đương cột Primesep B4   
21 Cột sắc ký  1 cái/Hộp Hộp SIELC L1-46.150.0510 Pha tĩnh octadecyl silane nối với silica hoặc các hạt gốm . Kích thước  4.6x150 mm, 5 µm, 100A. Tương đương cột Legacy L1
22 Cột sắc ký  1 cái/Hộp Hộp SIELC NAH-46.150.0510 Pha tĩnh hydrophobic ligand và cuối dây alkyl có nhóm trao đổi ion tích điện âm. Kích thước 4.6x150 mm, 5 µm, 100A. Tương đương cột Newcrom AH
23 Cột sắc ký 4.6x 250 mm, 5 µm, 100A 1 cái/Hộp Hộp SIELC S2-46.250.0510 Pha tĩnh nền axit gốc silica có đặc tính ưa nước. Tương đương cột Primesep S2
24 Cột sắc ký Eclipse XDB-C18 Cái Cái Agilent 971700-902 Kích thước 50 x 2.1 mm, 3.5 μm, pha tĩnh C18
25 Cột sắc ký khí 5MS UI 1 cáy/hộp Hộp Agilent – Mỹ/122-5532UI Kích thước 30 m x 0,25 mm; df: 0,25 µm; pha tĩnh 5%-Phenyl-methylpolysiloxane, ultra inert. Tương đương cột DB-5MS UI
26 Cột sắc ký lỏng   1 cái/Hộp Hộp Silec NBH-46.150.0510 Pha tĩnh hydrophobic ligand và cuối dây alkyl có nhóm trao đổi ion tích điện dương. Kích thước 4.6x150 mm, 5 µm, 100A. Tương đương cột  Newcrom BH
27 Cột sắc ký lỏng AQ-C18 (150 mm x 4.6 mm, kích thước hạt 3 µm) Cái Cái GL Sciences 5020-89860 Pha tĩnh AQ-C18, Kích thước (150 mm x 4,6) mm; kích thướt hạt 3 μm, Cacbon 13%. Tương đương cột Inertsil Sustain AQ-ODS-3V.
28 Cột sắc ký lỏng C18 (150 mm x 2.1 mm, kích thước hạt 3 µm) 1 cái/Hộp Hộp GL Sciences – Nhật/ 5020-07415 Pha tĩnh C18. Kích thước 2,1 mm x 150 mm; kích thước hạt 3 μm
29 Cột sắc ký lỏng C18 (150 mm x 4.6 mm, kích thước hạt 5 µm) 1 cái/Hộp Hộp GL Sciences – Nhật/ 5020-07345 Pha tĩnh C18. Kích thước 4,6 mm x 150 mm; kích thước hạt 5 μm, tương đương cột InertSustain
30 Cột sắc ký lỏng C8- 5µm, 250 x 4.6 mm 1 cái/Hộp Hộp Dikma 99803 Pha tĩnh C8, kích thước 250 mm x 4.6 mm, cỡ hạt 5μm, kích thước lỗ 100 Å, diện tích bề mặt 440 m2/g, Cacbon 10%, pH :2-7.5,có endcapping. Tương đương cột Diamonsil C8
31 Cột sắc ký lỏng NH2 (250 mm x 5mm, kích thướt hạt 5µm) 1Cái/ Hộp Hộp GL Sciences-Nhật/5020-16628 Kích thước: (250 x 4,6) mm
Kích thước hạt: 5 μm
Pha tĩnh: amino.
Diện tích bề mặt: 350 m2/g
Kích thước lỗ: 100 Å
Pore Volume: 0,85 mL/g
Tỉ lệ cacbon (Carbon loading): 7%
Phạm vi pH: 2-7,5
Tương đương cột InertSustain
32 Cột sắc ký primesep 100 - 4.6 x 250 mm, 5µm, 100A Cái Cái SIELC 100-46.250.0510 Dùng phân tích amino acid. Pha tĩnh là pha đão có đính nhóm ghép cặp ion. Kích thước 4,6 x 250mm, 5 μm, 100A
33 Cột sắc ký TG-5MS 1 cột/hộp hộp Thermo -  26098-1420 Pha tĩnh có 5% phenyl. Kích thước dài 30 m, đường kính 0.25 mm, bề dày film 0.25 µm, nhiệt độ làm việc từ -60oC đến 330/350oC. Tương đương cột TG-5MS
34 Cột sắc ký TG-624 Cái Cái Thermo -  26085-3320 Pha tỉnh 6% cyanopropylphenyl methypolysilozane. Kích thước dài 30 m, đường kính 0.25 mm, bề dày film 1.4 µm, nhiệt độ làm việc từ -20oC đến 240oC. Tương đương cột TG-624
35 Cột Silica HILIC Column, 100Å, 3 µm, 2.1 mm x 100 mm Cái Cái Water  186002013 Tương tác ưa nước, chất nền Silica. Kích thước 3 µm, 2.1 mm x 100 mm,  100Å
36 Đầu côn dẫn ion ngoài cho ICPMS bằng Nikel  1 Cái/hộp Hộp Perkin Elmer – Mỹ/ W1033612 Nikel sampler cone.
Phù hợp thiết bị ICP-MS NexION 350x.
Nhà cung cấp phải có tài liệu chứng minh khả năng lắp đặt, đánh giá
37 Đầu côn dẫn ion phía trong thứ cấp dùng cho ICPMS 1 Cái/hộp Hộp Perkin Elmer – Canada/ W1033995 Hyper skimmer cone.
Phù hợp thiết bị ICP-MS NexION 350x.
Nhà cung cấp phải có tài liệu chứng minh khả năng lắp đặt, đánh giá
38 Đầu côn dẫn ion trong cho ICPMS bằng Nickel 1 Cái/hộp Hộp Perkin Elmer – Canada/ W1026356 Nickel skimmer cone.
Phù hợp thiết bị ICP-MS NexION 350x.
Nhà cung cấp phải có tài liệu chứng minh khả năng lắp đặt, đánh giá
39 Đầu nối Colored finger – tight peek fittings 10/PK / Gói  Agilent – Mỹ/5065-4426 Vật liệu peek, đường kính ngoài 1,6 mm
40 Đầu nối cột Column nut for SSL 5 Cái/gói  Gói Thermo - 35050458 Phù hợp cho GC Thermo Trace 1310
41 Đầu nối cột sắc ký khí với bộ tiêm mẫu (Graphite/Vespel Ferrule 0.1-0,25 mm) 10 Cái/Gói Gói Thermo - 290VA191 Bằng graphite/vespel, sử dụng cho cột có đường kính 0,25 mm, phù hợp với buồng tiêm mẫu (inlet) Thermo Trace 1310
42 Đầu nối cột sắc ký khí với đầu dò khối phổ (Graphite/Vespel Ferrule 0.1-0,25 mm) 10 Cái/Gói Gói Thermo - 29033496 Bằng graphite/vespel, sử dụng cho cột có đường kính 0,25 mm, phù hợp với đầu dò khối phổ Thermo TSQ9000
43 Đầu phun APCI cho QTOF / Cái Sciex – Singapore/5049797 Phù hợp với nguồn ion hoá APCI QTOF X500R
44 Đầu phun cho đầu dò khối phổ APCI Capillary Electrode Cái Cái Sciex 025388 Loại ion hóa phun APCI , phù hợp cho nguồn ion Turbo V API 5500 của ABSciex
45 Đầu phun cho đầu dò khối phổ ESI Capillary Electrode Cái Cái  Sciex 25392 Loại ion hóa phun ESI, phù hợp cho nguồn ion Turbo V API 5500 của ABSciex
46 Đầu phun ESI cho QTOF / Cái Sciex – Singapore/5049795 Phù hợp với nguồn ion hoá ESI QTOF X500R
47 Đầu phun injector dùng cho  ICP-OES  1 cái/Hộp Hộp Perkin Elmer Đầu phun có khả năng chống ăn mòn đối với tất cả các axit khoáng bao gồm HF và nước cường toan.
48 Đầu phun mẫu
Glass Type C Nebulizer 0.5mL/min         
Cái Cái Perkin Elmer / N8145012       Phù hợp cho máy ICP-MS Nexion 350X của Perkin Elmer, tốc độ phun 0.5ml/phút
49 Đầu phun sương cho ICP-OES lưu lượng 1ml/phút (Nebulizer Type K1) 1 cái/Hộp Hộp Meinhard/Mỹ
(TR-50-K1)
Bộ phun sương, tốc độ phun 1mL/phút, phù hợp cho máy ICP-AVIO 500
50 Đèn D2 1 Cái/ Hộp Hộp Agilent – Đức/2140-0820 Dùng cho đầu dò DAD cùa LC  Infinity Agilent. Nhà cung cấp phải có tài liệu chứng minh khả năng lắp đặt, đánh giá.
51 Đèn XENON LAMP BULB ASSY 17.5V+-2V Cái Cái Shimadzu 228-51511-95 Đèn xenon cho đầu dò huỳnh quang RF-20. Nhà cung cấp phải có tài liệu chứng minh khả năng lắp đặt, đánh giá.
52 Đĩa petri thủy tinh Ø 90 mm  10 cái/Hộp  hộp Duran Đĩa có đường kính phần đáy là 90mm, cao 15mm. Chất liệu thủy tinh trong suốt, đáy và nắp phẳng, độ dày đồng nhất
53 Điện cực acid DG1115-SC cái cái Mettler Toledo51109504 Dùng chuẩn độ axit/bazơ, phạm vi đo lường pH từ 0-14, nhiệt độ hoạt động 0-100oC, chiều dài 149,5mm, đường kính 12mm. Phù hợp máy chuẩn độ điện thế Mettler Toledo T5, kiểm tra dụng cụ hoạt động tốt khi bàn giao.
54 Điện cực tủa DM1141-SC cái cái Mettler Toledo51109530 Điện cực bạc sủ dụng chuẩn độ tủa, phù hợp máy chuẩn độ Mettler Toledo T5, chiều dài điện cực  149,5mm, đường kính trục 12mm, phạm vi đo (-2000…2000)mV, nhiệt độ hoạt động (0-80)oC. Kiểm tra hoạt động khi giao hàng.
55 Dụng cụ phân phối chất lỏng 2-10 mL / Cái Hirschmann – Đức/ 9340000 Khoảng thể tích 2-10 mL, chịu acid mạnh, chất liệu piston: ceramic
56 Dụng cụ phân phối chất lỏng 2-10ml Cái Cái LH-723063, Sartorius - Biohit Dung tích pít-tông 2-10 mL, hấp tiệt trùng được ở 121oC, phù hợp chai thủy tinh có đường kính trong phần cổ chai 32mm, kèm adapter gắn được chai có đường kính trong cổ chai 28mm và 45mm. Pít-tông gốm, xi lanh thủy tinh, và các bộ phận cấu tạo từ fluoroplastic có tính đề kháng nhiệt và hóa chất 
57 Dụng cụ trợ pipet (Pipet aid) Cái Cái 710931, Sartorius Trọng lượng nhỏ (<250g); Pin sạc NiMH (bộ ba pin); bộ sạc dễ sử dụng; tốc độ pipet khoảng 10 ml/s; thích hợp gắn pipet thủy tinh 1-10ml, không lỏng lẻo; Màng lọc kỵ nước kích thước lỗ 0,45 µm có khả năng hấp được ở 121oC; hoạt động ở nhiệt độ phòng; bảo hành 2 năm. Có chân đế để đặt đứng trên bàn; có đèn báo pin yếu.
58 Găng tay cao su size M, không bột màu xanh  100 cái / Hộp  Hộp Vglove-Việt Nam Chất liệu cao su nhân tạo nitrile; cổ tay se viền chống tuột, bề ngoài nhám các đầu ngón tay. Loại size M màu xanh.
59 Găng tay cao su size S, không bột màu xanh  100 cái / Hộp   Hộp  Vglove-Việt Nam Chất liệu cao su nhân tạo nitrile; Cổ tay se viền chống tuột, bề ngoài nhám các đầu ngón tay. Loại size S màu xanh.
60 Heater gia nhiệt kim loại (Turbo heater Kit metal) / Cái Sciex – Singapore/5051082 Kim loại, phù hợp với nguồn ion hoá APCI Turbo V 5500
61 insert 250µl cho vial sắc kí 100 cái/ gói Gói alain/ 2ML-N2002 đế hình nón, 250µl, thủy tinh trong 6x29mm
62 Kìm đóng nắp  1 cái/hộp Hộp ALWSCI – Trung Quốc/C0000265 Kìm đóng nắp nhôm cho vial sắc ký kích cỡ 11mm 
63 Kim lấy mẫu cho bộ lấy mẫu tự động PerkinElmer AS-90 / 90A / 90 Plus / 91/93 Plus / S10 Bộ Bộ Perkin Elmer / B3001770 Phù hợp cho máy ICP-MS Nexion 350X của Perkin Elmer 
64 Kìm mở nắp 1 cái/hộp Hộp ALWSCI – Trung Quốc/C0000268 Kìm mở nắp nhôm cho vial sắc ký kích cỡ 11mm 
65 Kim tiêm mẫu tự động sắc ký khí 10 µl 1 Cây/Gói Gói Agilent/ 8010-0351 Kim tiêm mẫu cho sắc ký khí, thể tích 10 µL, chiều dài 50 mm, 23 gauge, cone tip;sử dụng cho hệ tiêm mẫu tự động GC PAL 
66 Kim tiêm mẫu tự động Syring 10ul 1 cái/hộp Hộp Agilent – Romania/G6500-80116 Thể tích: 10µL
Mũi kim tròn đầu (Cone)
Kim dính liền với Syringe
Chiều dài needle: 51 mm
Needle gauge: 26s
Phù hợp cho bộ tiêm mẫu tự động CTC CompiPal 
67 MicoPipet đơn kênh 100 µL – 1.000 µL / Cái Mettler Toledo – Mỹ/ 17014382 Thể tích hút từ 100 – 1000 µL,
Số gia ≤ 2 µL,
Sai số hệ thống:
 -Tại 100 µL: ± ≤ 3%;
- Tại 500 µL: ± ≤ 0,8%;
- Tại 1000 µL: ± ≤ 0,8%.
Sai số ngẫu nhiên:
- Tại 100 µL: ± ≤ 0,6%;
- Tại 500 µL: ± ≤ 0,2%;
- Tại 1000 µL: ± ≤ 0,15%.
Tương thích với loại đầu tip Lite Touch
68 MicoPipet đơn kênh 20-200µl     / Cái Mettler Toledo – Mỹ/ 17014391 Thể tích hút từ 20 – 200 µL,
Số gia ≤ 0,2 µL,
Sai số hệ thống:
 -Tại 20 µL: ± ≤ 2,5%;
- Tại 100 µL: ± ≤ 0,8%;
- Tại 200 µL: ± ≤ 0,8%.
Sai số ngẫu nhiên:
- Tại 20 µL: ± ≤1%;
- Tại 100 µL: ± ≤ 0,25%;
- Tại 200 µL: ± ≤ 0,15%.
Tương thích với loại đầu tip Lite Touch
69 Miếng đệm Septa Coated BTO 11 mm  5 Cái/Hộp  Hộp Thermo - 31303246 Phù hợp Liner SSL của buồng tiêm mẫu GC Thermo Trace 1310
70 Nắp nhôm (11 mm) cho vial 2mL 100 cái/ gói Gói La-Pha-Pack;11030209 Nắp nhôm có đệm cho chai miệng 11mm, lỗ, đệm Natural Rubber red-orange/TEF transparent.
71 Nắp vặn nhựa có septa cho vial 2 mL 100 Cái/ Gói  Gói Membrane Solutions – Trung Quốc/LBSV222CSS Nắp vặn màu xanh; chất liệu: Polypropylene, có lỗ ở giữa, đường kính: 7mm; chất liệu miếng lót bên trong nắp: mặt trên là silicone trắng/mặt dưới là PTFE có màu xanh, ở giữa có rãnh, tương thích với chai 2mL 
72 Needle assy cho bộ tiêm mẫu SIL-30AD Cái Cái Sciex 228-41024-95 Phù hợp cho bộ tiêm mẫu SIL-30AD của Sciex
73 Needle seal cho bộ tiêm mẫu SIL-30AD Cái Cái Sciex 228-52253-00 Phù hợp cho bộ tiêm mẫu SIL-30AD của Sciex
74 Nón con sâu 100 cái/Bịch Bịch Vật liệu vải không dệt, màu xanh dương
75 Ống hút pasteur 500 cái/hộp Hộp Apataca - Ý/1502 Thể tích 3mL, vật liệu: nhựa PP
76 Ống ly tâm nhựa 15 ml 500 Cái/thùng Thùng Jetbiofil – Trung Quốc/CFT000150 Vật liệu: nhựa PP, chịu được nhiệt độ ≥1200C, dung môi hữu cơ, acid vô cơ, tương đương Jet biofil
77 Ống ly tâm nhựa 50ml   500 Cái/ Thùng Thùng Jetbiofil – Trung Quốc/CFT000500 Vật liệu: nhựa PP, chịu được nhiệt độ ≥1200C, dung môi hữu cơ, acid vô cơ, tương đương Jet biofil
78 Ống sinh hàn xoắn cái cái Duran242537105 làm bằng thủy tinh borosilicate 3,3 chịu nhiệt, chiều dài 300mm, kích thước đầu cắm NS 24/29, cone NS 24/29, ó khả năng kháng hóa chất tốt, trơ về mặt hóa học và chịu được nhiệt độ cao, sản phẩm được sử dụng để ngưng tụ và hồi lưu hơi nước (dung môi) về các hỗn hợp phản ứng.
79 Phin lọc mẫu 30mm; 1 um 100 cái /Gói Gói Membrane Solutions/ SFNY 030100NA Vật liệu màng lọc: Nylon, kích thước màng lọc 30 mm, kích thước lỗ 1 µm
80 Phin lọc mẫu Nylon (kích thước lỗ 0,45µm,kích thước màng lọc 13mm)  100 Cái /Gói Gói Newstar – Trung Quốc/NS20801304 Vật liệu màng lọc: Nylon, kích thước màng lọc 13 mm, kích thước lỗ 0,45 µm
81 Phin lọc mẫu PES (kích thước lỗ 0.45 µm, kích thước màng lọc 25 mm 100 Cái /Gói Gói Dikma- 30020 Vật liệu màng lọc: Polyethersulfone, kích thước màng lọc 25 mm, kích thước lỗ 0,45 µm, thể tích lọc ≥ 100 ml, áp suất ≥ 85 PSI
82 Phin lọc mẫu PTFE  (kích thước màng lọc 0.45 µm, kích thước màng lọc 25 mm) 100 Cái /Gói Gói Dikma- 37192 Vật liệu màng lọc: PTFE, kích thước màng lọc 25 mm, kích thước lỗ 0,45 µm, thể tích lọc ≥ 100 ml, áp suất ≥ 100 PSI
83 Phin lọc mẫu PTFE (kích thước màng lọc 0.45 µm, kích thước màng lọc 13 mm) 100 Cái /Gói Gói Dikma-37182 Vật liệu màng lọc: PTFE, kích thước màng lọc 13 mm, kích thước lỗ 0,45 µm, thể tích lọc ≥ 10 ml, áp suất ≥ 100 PSI
84 Pipet cơ đơn kênh  1-10 ml   Cái Cái Mettler Toledo – Mỹ/ 17011795 Thể tích hút từ 1000 – 10000 µL,
Số gia ≤ 20 µL
Độ đúng (Accuracy) :
-Tại 1 ml : ± ≤ 5 %;
-Tại 5 ml : ± ≤  1 %;
-Tại 10 ml : ± ≤ 0,6 %.
Dùng được mọi loại đầu tip
85 Pipet cơ đơn kênh  500-5000µl     / Cái Mettler Toledo – Mỹ/ 17011801 Thể tích hút từ 500 – 5000 µL,
Số gia ≤ 5 µL,
Sai số hệ thống:
 -Tại 500 µL: ± ≤ 2,4%;
- Tại 2500 µL: ± ≤ 0,6%;
- Tại 5000 µL: ± ≤ 0,6%.
Sai số ngẫu nhiên:
- Tại 500 µL: ± ≤ 0,6%;
- Tại 2500 µL: ± ≤ 0,2%;
- Tại 5000 µL: ± ≤ 0,16%.
Dùng được mọi loại đầu tip
86 Sợi đốt Filament 1 cái/hộp Hộp Thermo - 1R120404-1900 Dual filament phù hợp cho máy GC-MSMS TSQ9000
87 Túi dập mẫu  500 cái /hộp  Hộp 132050, Interscience Túi dập mẫu tiệt trùng tia gamma; thể tích chứa lớn nhất 400mL, kích thước túi 175x300 mm, không màu, chất liệu polysilk, có thể bảo quản trong tủ đông -20oC
88 Túi kỵ khí 10 miếng/ gói Gói AnaeroGen (AN0025), Oxoid Hợp chất trong mỗi túi là ascorbic acid. Dạng miếng, sử dụng ngay, không cần bổ sung nước, kích thước phù hợp với bình ủ kỵ khí dung tích 2,5L, sử dụng 1 túi cho 1 bình 2,5L, bảo quản được ở nhiệt độ phòng, có giấy chứng nhận chất lượng
89 Van áp suất cao 30A cho bộ tiêm mẫu SIL-30AD Cái Cái Sciex 228-52139-00 Phù hợp cho bộ tiêm mẫu SIL-30AD của Sciex
90 Van áp suất thấp 30A cho bộ tiêm mẫu SIL-30AD Cái Cái Sciex 228-51922-00 Phù hợp cho bộ tiêm mẫu SIL-30AD của Sciex
91 Van ra cho bơm LC-30AD Cái Cái Sciex 228-53334-92 Phù hợp cho bơm LC-30AD của Sciex
92 Van vào cho bơm LC-30AD Cái Cái Sciex 228-52964-93 Phù hợp cho bơm LC-30AD của Sciex
93 Vòng đệm Liner sealing O-Ring for SSL 5 Cái/gói  Gói Thermo - 29001320 Phù hợp Liner SSL của buồng tiêm mẫu GC Thermo Trace 1310
Cột sắc ký lỏng C18 (150 mm x 2,1 mm, kích thước hạt 3 µm) 1 cái/Hộp Hộp GL Sciences – Nhật/ 5020-07415 Pha tĩnh C18. Kích thước 2,1 mm x 150 mm; kích thước hạt 3 μm
Cột bảo vệ (Guard column HILIC) và bộ đỡ cột (Holder) / Bộ GL Sciences – Nhật/ 5020-19375 Bộ bao gồm 2 cột bảo vệ và 1 đỡ cột. Cột bảo vệ dài 10 mm, đường kính trong 1,5mm, kich thước hạt 3um. Tương đương cột bảo vệ HILIC và bộ đỡ Inertsil
Dây hút dùng cho bơm nhu động
1.14 mm I.D., Red/Red/Red, Pkg. 6
06 dây /Gói Gói Perkin Elmer; B3140730 Phù hợp cho máy ICP AVIO 500 của Perkin Elmer, đường kính trong 1,14 mm
Dây hút dùng cho bơm nhu động
2.79 mm I.D., Purple/White/Purple, Pkg. 6
06 dây /Gói Gói Perkin Elmer; B3140721 Phù hợp cho máy ICP AVIO 500 của Perkin Elmer, đường kính trong 2,79 mm
Dây hút dùng cho bơm nhu động
0.76 mm I.D., Black/Black, Pkg. 12
12 dây /Gói Gói Perkin Elmer; 473550 Phù hợp cho máy ICP AVIO 500 của Perkin Elmer, đường kính trong 0,76 mm
Dây hút dùng cho bơm nhu động
1.14 mm I.D., Red/Red, Pkg. 12
12 dây /Gói Gói Perkin Elmer; 9923037 Phù hợp cho máy ICP AVIO 500 của Perkin Elmer, đường kính trong 0,76 mm
Đầu đốt thạch anh 1 khe 1 cái/Hộp Hộp Perkin Elmer; N0790131 Phù hợp cho máy ICP AVIO 500 của Perkin Elmer
Giấp pH 1-14 / Cuộn Merck; 1109620003 Giấy đo pH 1-14 ; Cuộn dài 4,8m với màu pH 1 – 2 – 3 – 4 – 5 – 6 – 7 – 8 – 9 – 10 – 12 – 13 – 14
Dây dẫn 0,25-mm (0,010-in)ID PEEK / in Thermo Scientific 042690 Chất liệu PEEK, đường kính dẫn 0,25mm(0,010in); màu đen.
1 Comment
Avatar
Discard
Avatar
CP
-

HPLC Column ZORBAX Eclipse, XDB-C18, 80Å, 3,5 µm, 2,1 x 50 mm 971700-902

Diamonsil C8, 5um, 250 x 4.6mm HPLC-Column 99803